Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-150 precursor URS00006B7D0F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR150: MIR150 is a microRNA that has been studied in various contexts [PMC6269310]. In one study, the dual regulatory mechanisms of MIR150 expression were investigated, including direct transcriptional activation by MYC and the post-transcriptional inhibition of miR-150 maturation by MYC-driven Lin28 [PMC6269310]. However, the data did not show repression of miR-150 maturation blockade following BCR-ABL1 inhibition in CML cells [PMC6269310]. Another study found that a proximal peak in MIR150 expression coincided with the miR-150 sequence and quickly disappeared after stimulation in naive and memory resting T lymphocytes, suggesting a possible role in the direct control of MIR150 expression [PMC8865640]. Additionally, MIR150 has been identified as one of several free circulating miRNAs that have been isolated in plasma/serum before HCT (hematopoietic cell transplantation), suggesting a possible prognostic use in GVHD (graft-versus-host disease) [PMC9720327]. Furthermore, liver tumor-derived lncRNAs (such as TUC339), circRNAs (such as hsa_circ_0074854), and miRNAs (such as MIR150) have been implicated as critical signaling mediators that orchestrate macrophage M1/M2 polarization [PMC9648394].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUCCCCAUGGCCCUGUCUCCCAACCCUUGUACCAGUGCUGGGCUCAGACCCUGGUACAGGCCUGGGGGACAGGGACCUGGGGAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications