Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-520h precursor URS00006B6CC5_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR520H: MIR520H is an upregulated miRNA that has been associated with poor prognosis in various diseases, including liver cancer (HCC) [PMC7827149]. In a study analyzing the TCGA miRNA-seq dataset of liver cancer, MIR520H was found to be one of the upregulated miRNAs [PMC7378193]. Another study found that MIR520H was upregulated in women with recurrent pregnancy loss (RPL) compared to normal controls [PMC5572592]. Additionally, MIR520H has been implicated in breast cancer cell resistance to paclitaxel by attenuating the stability of the tumor suppressor PTEN and activating the Akt pathway [PMC8394096]. Furthermore, MIR520H is part of a cluster of miRNAs on chromosome 19 known as C19MC, which has been associated with stem cell biology and tumorigenesis [PMC8508841]. In breast invasive carcinoma, cumulative expression analysis revealed upregulation of MIR520H along with other C19MC miRNAs [PMC6193703]. Overall, upregulation of MIR520H has been consistently associated with poor prognosis in various diseases. Its involvement in tumorigenesis and resistance to treatment highlights its potential as a therapeutic target. However, further research is needed to fully understand its mechanisms and potential clinical applications.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCCAUGCUGUGACCCUCUAGAGGAAGCACUUUCUGUUUGUUGUCUGAGAAAAAACAAAGUGCUUCCCUUUAGAGUUACUGUUUGGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications