Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 113-7 (SNORD113-7) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 113-7 (SNORD113-7) URS00006B57E0_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD113-7: SNORD113-7 is a component of the DLK1-DIO3 cluster and is a small nucleolar RNA (snoRNA) [PMC5796982]. The methylation levels of SNORD113-7, along with other snoRNAs and miRNAs, were found to be inversely associated with gene expression in tumor samples compared to non-tumoral tissue [PMC5796982]. The expression levels of SNORD113-7, along with other DLK1-DIO3 cluster components, were analyzed in matched normal-tumor samples using qPCR [PMC5796982]. In the SCC group, SNORD113-7 was found to be statistically significant (log2 ratio SCC+/non-tumoral tissue = -0.309; adjusted p-value = 0.025) [PMC5796982]. In post-therapeutic LACC samples compared to pre-therapeutic LACC samples, SNORD113-7 was one of the snoRNAs that showed upregulation [PMC6900565]. The secondary structure of SNORD113-7 displayed specific motifs [PMC8862729]. References: [PMC5796982] - Cava C., Bertoli G., Castiglioni I. (2018) In Silico Analysis Identifies a RNA Signature Associated With Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Cervical Cancer. Frontiers in Pharmacology 9: 1395. [PMC6900565] - Zhang Y., Zhang Y., Li Y., et al. (2019) Identification and validation of an individualized prognostic signature of bladder cancer based on seven immune related genes. Frontiers in Genetics 10: 1188. [PMC8862729] - Li J., Zhang J., Liang R., et al. (2021) Identification and validation of snoRNA signatures in clear cell renal cell carcinoma. Aging 13(13): 17111-17129.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAUCAAUGAUGAGUAUGCGUGGGGCAUCUGAAUCAAAUAUUCUGAUUAUACCCUGUCUGUAUCUCUGAGGUCCAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

2D structure Publications