Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 12 (SNORD12) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 12 (SNORD12) URS00006B5455_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD12: SNORD12 is a small nucleolar RNA (snoRNA) that is part of the SNORD12 family, which includes SNORD12B and SNORD12C. These snoRNAs are encoded within the host gene ZFAS1 and are involved in the chemical modifications of other RNAs, such as transfer RNAs, ribosomal RNAs, and small nuclear RNAs [PMC3225313] [PMC7154078] [PMC4990377]. SNORD12 has been found to exhibit higher expression levels in certain cells compared to others, indicating its potential role in cell differentiation [PMC7154078]. ZFAS1, which encodes SNORD12, has been associated with various cancers including breast cancer and colorectal cancer [PMC4990377] [PMC7243338]. However, its role in hepatocellular carcinoma (HCC) remains largely unknown [PMC4990377]. Additionally, ZFAS1 has been observed to be significantly overexpressed in various human malignancies and may serve as a potential biomarker for breast cancer [PMC7243338]. The expression of SNORD12 can be regulated independently of ZFAS1 expression, suggesting that the cellular effects observed following ZFAS1 silencing are not solely due to changes in SNORD12 levels [PMC4808022]. Overall, the SNORD12 family members have been implicated in various cellular processes and have potential clinical implications as biomarkers for cancer.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCUUUGCAGCUGAUGAUACAGCUUCUUUCCCCAUCAGAUCGACCCUGUUGAUCUCUACACUAUUGGCCAGUUUUGUCUGAUGCAUUGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

2D structure Publications