v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 58C (ENSG00000202093.1) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 58C (ENSG00000202093.1) URS00006ADC79_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD58C: SNORD58C is a small nucleolar RNA (snoRNA) that has been identified as a member of the SNORD58 family [PMC8178906]. It is one of the most expressed members of the SNORD58 family in testis [PMC8178906]. SNORD58C has been predicted to modify a specific ribosomal RNA (rRNA) molecule [PMC2817437]. The structure of SNORD58C snoRNA has been predicted using the RNAfold online server, which determines RNA structure based on minimum free energy and partition function [PMC3979666]. The base coverage of a CLIP cluster around SNORD58C has been shown in a figure, indicating its reliable identification by MiClip [PMC3979666]. The RNA sequence of SNORD58C on the negative strand can be found in the UCSC Genome Browser [PMC3979666]. It has been observed that knockdown of SNORD58C results in an extremely small knockdown vs. control ratio, indicating its potential functional importance [PMC3979666]. References: - PMC4914119 - PMC8178906 - PMC8742282 - PMC8374107 - PMC2817437 - PMC3979666

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUGCUGUGAUGACUAUCUUAGGACACCUUUGGAAUAACUAUGAAAGAAAACUAUUCUGAGCAAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Cercocebus atys Small nucleolar RNA SNORD58 (ENSCATG00000007310.1)
  2. Chlorocebus sabaeus (African green monkey) Small nucleolar RNA SNORD58 (ENSCSAG00000020111.1)
  3. Gorilla gorilla gorilla Small nucleolar RNA SNORD58
  4. Macaca fascicularis (Crab-eating macaque) Small nucleolar RNA SNORD58 (ENSMFAG00000007576.2)
  5. Macaca mulatta Small nucleolar RNA SNORD58 (ENSMMUG00000025201.3)
  6. Macaca nemestrina Small nucleolar RNA SNORD58 (ENSMNEG00000025803.1)
  7. Mandrillus leucophaeus Small nucleolar RNA SNORD58 (ENSMLEG00000027023.1)
  8. Nomascus leucogenys (Northern white-cheeked gibbon) Small nucleolar RNA SNORD58
  9. Pan paniscus Small nucleolar RNA SNORD58 (ENSPPAG00000003525.1)
  10. Pan troglodytes Small nucleolar RNA SNORD58
  11. Papio anubis Small nucleolar RNA SNORD58 (ENSPANG00000010917.3)
  12. Piliocolobus tephrosceles Small nucleolar RNA SNORD58 (ENSPTEG00000019111.1)
  13. Pongo abelii Small nucleolar RNA SNORD58 (ENSPPYG00000025552.2)
  14. Rhinopithecus bieti Small nucleolar RNA SNORD58 (ENSRBIG00000019593.1)
  15. Rhinopithecus roxellana Small nucleolar RNA SNORD58 (ENSRROG00000024033.1)
 2D structure Publications