Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-520d precursor URS00006A9A0F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR520D: MIR520D is a miRNA gene that is part of the C19MC miRNA gene cluster [PMC7378193]. It has been studied in various cancer types, including hepatocellular carcinoma (HCC) and breast invasive carcinoma [PMC7378193] [PMC6193703]. In HCC, the TCGA miRNA-seq dataset was used to analyze the cumulative expression of all 46 C19MC miRNA genes, including MIR520D, and integrate it with RNA-seq data [PMC7378193]. In breast invasive carcinoma, a similar analysis was performed to determine the cumulative expression of C19MC miRNA genes, including MIR520D [PMC6193703]. MIR520D has been found to regulate MXD1 and is associated with positive regulation of specific transcription from RNA polymerase II promoter, cell cycle regulation, and regulation of action potential in neurons [PMC6053825]. Additionally, it has been observed that CNVs can disrupt MIR520D and other miRNA genes such as mir1324 and mir1283. These disrupted miRNAs share common targets such as NEDD9 that are also influenced by CNVs [PMC3938728]. In a study comparing non-responders and responders in cancer treatment, it was found that MIR4520-2 was downregulated in non-responders [PMC6616969].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUCAAGCUGUGAGUCUACAAAGGGAAGCCCUUUCUGUUGUCUAAAAGAAAAGAAAGUGCUUCUCUUUGGUGGGUUACGGUUUGAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications