Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-1265 precursor URS00006A766D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1265: Hsa-mir-1265 is a key microRNA (miRNA) that has been implicated in various diseases, including colorectal cancer, pancreatic cancer, and lung adenocarcinoma (LUAD) [PMC8544338] [PMC7962059] [PMC6380039]. It has been found to be upregulated in response to cadmium (Cd) stress [PMC4609416]. Hsa-mir-1265 has been shown to target the YWHAZ gene and may function as a sponge for hsa-mir-1265, leading to increased expression levels of YWHAZ and promoting tumorigenesis of LUAD [PMC6380039]. Additionally, hsa-mir-1265 has been identified as one of the miRNAs that target the MEG3 gene [PMC8695896]. It is also predicted to regulate several single nucleotide polymorphisms (SNPs) through its binding activity, including rs1050541 and rs1050540 in the TP53 gene [PMC8956157]. Furthermore, hsa-mir-1265 has shown differential expression patterns in various bioinformatic analyses and may be involved in regulating genes such as C2CD4A [PMC8520208] and miRNAs such as hsa-miR-579 and hsa-miR-1224-5p [PMC8956157]. Overall, hsa-mir-1265 is a versatile miRNA that plays a role in multiple diseases and regulatory processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUGGUUUGGGACUCAGGAUGUGGUCAAGUGUUGUUAAGGCAUGUUCAGGAACAAUACUUGACCACAUUUUGAAUUCCAAACCAUAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications