Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-877 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-877 precursor URS00006A5378_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-877: hsa-mir-877 is a microRNA that has been reported as an oncogene in gastric cancer [PMC7794682]. In nonresponder samples of both lung squamous cell carcinoma (LUSC) and head and neck squamous cell carcinoma (HNSC), hsa-mir-877 was found to be upregulated, along with hsa-miR-130a and hsa-miR-15a [PMC7794682]. Furthermore, in a study on endometrial cancer (EC), hsa-mir-877 was identified as one of the candidate reference genes that showed uniform expression [PMC3531299].

MIR877: MIR877 is a miRNA that has been identified as playing a role in inhibiting the development of pulmonary fibrosis and increasing the levels of the inhibitory protein Smad7 [PMC6957807]. It is a molecular target that may be responsible for the therapeutic effects of CPV in treating respiratory disorders [PMC6957807]. CPV has been found to regulate miRNAs, including MIR877, which are involved in anti-diabetic, anti-fibrotic, and anti-inflammatory activities [PMC6957807]. In animals treated with CPV, down-regulation of MIR877 was observed in the liver [PMC6957807]. In individuals with disrupted CNVs, MIR877 was found to be disrupted along with its target gene ARHGAP26 [PMC3938728]. Additionally, MIR877 has been identified as one of the miRNAs that are more abundant during the G2M phase [PMC8713755]. In a study on primary biliary cholangitis (PBC) and primary sclerosing cholangitis (PSC), a SNP located between PSORS1C3 and MIR877 was strongly associated with PSC [PMC5217265]. Overall, these findings highlight the importance of MIR877 in various biological processes and its potential as a therapeutic target for respiratory disorders and liver diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUAGAGGAGAUGGCGCAGGGGACACGGGCAAAGACUUGGGGGUUCCUGGGACCCUCAGACGUGUGUCCUCUUCUCCCUCCUCCCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

2D structure Publications