Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box U73B (ENSG00000201264.1, ENSG00000292162.1) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box U73B (ENSG00000201264.1, ENSG00000292162.1) URS00006A4258_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD73B: SNORD73B is a C/D box small nucleolar RNA (snoRNA) that has been identified as a potential biomarker for non-small-cell lung cancer (NSCLC) [PMC4472183]. In a study on NSCLC, SNORD73B, along with SNORD33, SNORD66, SNORD76, and SNORD78, was found to have strong diagnostic potential in non-small cell lung carcinoma [PMC8677010]. These snoRNAs were reliably detectable in the plasma of NSCLC patients at significantly higher levels compared to healthy controls or patients with chronic obstructive pulmonary disease (COPD) [PMC4913179]. Additionally, C/D box snoRNAs including SNORD73B were found to be significantly upregulated in NSCLC [PMC9826665]. In another study on patients with pseudoexfoliation glaucoma (PEXG), SNORD73B was one of the snoRNAs that showed statistically significant lower expression compared to the control group [PMC9454646]. Furthermore, enrichment analyses revealed associations between SNORD73B and genes such as CACNA3, FAM120AOS, RPS2, and TNPO2 [PMC9454646]. Although measurable plasma expressions of SNORA42 and SNORD78 were found in NSCLC patients and healthy individuals, there were no significant differences between the groups for these snoRNAs [PMC2919450]. Overall, studies have identified upregulated expression of snoRNAs including SNORD33, SNORD66, and SNORA42 in non-small cell lung cancer samples [PMC6769540], as well as their overexpression in both adenocarcinoma (AC) and squamous cell carcinoma (SCC) subtypes of NSCLC [PMC4427830].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAUGAAUGAUGACAAAAUGUUUCAGUCCCAAAUGAUACAUACUGAUUAUACCAUUAUAUUUAUCCUGACAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications