Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 71 (SNORD71) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 71 (SNORD71) URS00006A38AA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD71: SNORD71 is a small nucleolar RNA (snoRNA) that has been implicated in various diseases, including T-cell lymphoma and chronic B-cell lymphocytic leukemia (CLL) [PMC8389557] [PMC8677010] [PMC9219770]. It has been found to be overexpressed in cases of T-cell lymphoma with a favorable outcome [PMC8677010]. In CLL, SNORD71, along with other snoRNAs such as SNORD35b and SNORD116-11, showed differential expression compared to normal B-cells [PMC9219770]. SNORD71 has also been identified as highly expressed in HMEC and HCC1954 cells [PMC4338251]. In cancer samples, sd/miR-768-5p, which is derived from SNORD71, was significantly downregulated [PMC9404758]. Additionally, snoRNA HBII-239 (SNORD71)-derived miRNA precursors have been found to bind to fibrillarin protein [PMC5765200]. Although specific snoRNA signatures associated with CLL outcome have not been identified, a snoRNA profile including SNORD35B and SNORD116-25 was able to discriminate between healthy B-cells and leukemic cells in CLL samples [PMC8629011]. Furthermore, the human Y-box binding protein 1 (YB-1) has been shown to bind SNORD71 and associate with hnRNP A1 protein [PMC8467515]. Conservation of the SNORD71 sequence has been observed across vertebrates including humans [PMC5579392]. In peripheral T-cell lymphoma, overexpression of SNORD71 is associated with a favorable outcome [PMC4627319]. Additionally, other small nucleolar RNAs such as SNORA80 have shown an association with progression from smoldering to symptomatic multiple myeloma (MM) [PMC3766210]. SNORD71 has also been identified as a transcript specific to MCF7 cells [PMC8713755]. Overall, SNORD71 has been implicated in various diseases and has potential clinical relevance as a biomarker and prognostic marker in cancer.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUGUGUUGGAGGAUGAAAGUACGGAGUGAUCCAUCGGCUAAGUGUCUUGUCACAAUGCUGACACUCAAACUGCUGACAGCACACG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications