v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-449a precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-449a precursor URS00006A0D74_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR449A: MIR449A is a type of endogenous regulator of MET-mediated EMT, along with miR-148a and SENP1 [PMC5643285]. It has been found to play a role in H9C2 cell damage caused by H/R, and its functional association with NR4A2 has been investigated [PMC8406901]. These findings highlight the importance of MIR449A in regulating cellular processes and its potential role in various biological contexts [PMC5643285][PMC8406901].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUGUGUGUGAUGAGCUGGCAGUGUAUUGUUAGCUGGUUGAAUAUGUGAAUGGCAUCGGCUAACAUGCAACUGCUGUCUUAUUGCAUAUACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Nomascus leucogenys microRNA 449a (ENSNLEG00000022771.2)
 2D structure Publications