Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) RNA, variant U1 small nuclear 15 (RNVU1-15) secondary structure diagram

Homo sapiens (human) RNA, variant U1 small nuclear 15 (RNVU1-15) URS000069B06F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

RNVU1-15: RNVU1-15 is a promoter for Pol II snRNA transcription, with a high median precision score of 0.86 [PMC9758055]. It is moderately to highly expressed in the nervous system and whole blood [PMC7220435]. RNVU1-15 is one of the nine snRNAs in the snRNA signature, which also includes RNU1-16P, RNU6-1031P, RNU6-258P, RNU6-335P, RNU6-485P, RNU6-549P, RNU6-98P, and RNU6ATAC26P [PMC6855622]. Some of these ncRNAs, including POLR2KP2 and TUBB2BP1 in addition to RNVU1-15 and others mentioned above, are moderately to highly expressed in neurons and may be associated with ASD pathogenesis in the brain [PMC7828397]. Furthermore, a study identified RNVU1-15 as one of the potential biomarkers for colorectal adenocarcinoma (COAD) for the first time [PMC9444393]. This study also investigated the molecular mechanism affecting initial lymphatic metastasis in COAD patients and identified six core genes including RNVU1-15 [PMC9444393]. Univariate analysis showed that both RNVU1-15 and another gene called RNA4-U2 (RNU4-U2) were significant and could be included in a multivariate regression model [PMC9444393]. Additionally, both RNA4-U2 (RNU4-U2) and RNVU1-15 are involved in RNA processing related to suicide and autism [PMC9444393].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUACUUACUUGGCGGGGGAGAUACCAUGAUCACGAAGGUGGUUUUCUCAGGGCGAGGCUUAUCCGUUAUGUUCCGGGUGUACUGACCCCUGCCAUUUUCCCCCAAUGUGAGGAACUCGACUGCAUAACUUGUGAUAGUAGGGGACUGCGUUCGCGCUUUCCCCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications