Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-940 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-940 precursor URS0000699E19_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR940: MIR940 is a microRNA (miRNA) that has been implicated in various biological processes and diseases, including hepatocellular carcinoma (HCC) cell viability and invasion [PMC6433657]. MiRNAs are short non-coding RNAs that regulate gene expression by binding to the 3'-untranslated region (UTR) of target messenger RNAs (mRNAs) [PMC6433657]. They play important roles in tumor biology, including cell proliferation, migration, apoptosis, and metastasis [PMC6433657]. In the context of nasopharyngeal carcinoma (NPC), several miRNAs have been found to be closely associated with its occurrence and development [PMC7534087]. For example, miR-17-5p has been shown to promote NPC cell proliferation by inhibiting p21 expression [PMC7534087]. Additionally, let-7a down-regulates HMGA2 expression level, inhibiting NPC cell invasion and epithelial-mesenchymal transition process [PMC7534087]. MiR-548 and MIR940 have been identified as potential diagnostic biomarkers for NPC with high sensitivity and specificity [PMC7534087][PMC7072613][PMC5737662][PMC6700302]. Furthermore, an integrated analysis of miRNA and mRNA microarray data revealed that the hsa-miR-423-5p/MYC signature is pivotal for NPC diagnosis [PMC7534087][PMC9924325]. MIR940 has also been implicated in other cancers such as pancreatic cancer and gastric cancer [PMC7250935][PMC4944467]. In summary, MIR940 is a miRNA that plays important roles in various biological processes and diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGAGGUGUGGGCCCGGCCCCAGGAGCGGGGCCUGGGCAGCCCCGUGUGUUGAGGAAGGAAGGCAGGGCCCCCGCUCCCCGGGCCUGACCCCAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

2D structure Publications