Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-34b precursor URS0000699DB3_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR34B: MIR34B is a member of the miR34 family and has been observed to be present only in the MB436 cell line, which is a subtype of triple-negative breast cancer (TNBC) [PMC8261273]. The miR34 family, which includes miR34A, MIR34B, and miR34C, has been recognized as tumor suppressors and has been implicated in various cellular processes that control carcinogenesis [PMC4039115]. These processes include cell cycling, apoptosis, somatic cell reprogramming, and metastasis [PMC4039115]. The presence of MIR34B in the MB436 cell line suggests its potential role as a tumor suppressor in TNBC. The miR34 family's involvement in cellular processes that regulate carcinogenesis highlights its significance in cancer development and progression. Understanding the specific functions of MIR34B within these processes could provide valuable insights into TNBC pathogenesis and potential therapeutic targets. Further research is needed to elucidate the precise mechanisms by which MIR34B functions as a tumor suppressor and its potential implications for TNBC treatment [PMC4039115].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGCUCGGUUUGUAGGCAGUGUCAUUAGCUGAUUGUACUGUGGUGGUUACAAUCACUAACUCCACUGCCAUCAAAACAAGGCAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

Publications