Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 19B (ENSG00000238862.1) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 19B (ENSG00000238862.1) URS0000698D61_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD19B: SNORD19B is a small nucleolar RNA (snoRNA) that has been associated with major psychiatric mood disorders and lipid and glucose abnormalities in patients using atypical or second-generation antipsychotics [PMC4382905] [Pramyothin and Khaodhiar, 2010]. In hepatocellular carcinoma (HCC), high expression levels of SNORD19B were shown to be prognostic of shorter time to relapse [PMC8677010]. SNORD19B is one of the genes that regulate the process of mobility [PMC4637305]. In a study on bladder cancer (BLCA), SNORD19B was found to be a beneficial factor for patients, as indicated by KM survival curves [PMC7350589]. SNORD19B, along with other snoRNAs, was identified as an independent prognostic factor in cancer and was used to construct a prognostic risk score model [PMC9454744]. The expression of SNORD19B was negatively correlated with ACVRL1 in bladder cancer patients [PMC7350589]. Additionally, the expression of SNORD19B was positively correlated with its copy number variation (CNV) in bladder cancer patients [PMC7350589]. Furthermore, SNORD19B had a correlation with CD20 in bladder cancer patients [PMC7350589].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUUGGUUGAAAUAUGAUGAGUGUACAAAAUCUUGAUUUAAGUGAAUGAAAAAUUACAAGAUCCAACUCUGAUUUCAGCCAGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications