Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 114-11 (SNORD114-11) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 114-11 (SNORD114-11) URS00006926AF_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD114-11: SNORD114-11 is a member of the small nucleolar RNA, C/D Box 114 cluster (SNORD114) family, and it is downregulated in metastatic ovarian cancer compared to primary tumors [PMC8677010]. In metastatic ovarian cancer, SNORD114-2, SNORD114-10, and SNORD114-11 are downregulated [PMC8677010]. Additionally, in omental tissues, SNORD114-10, SNORD114-2, and SNORD114-11 are downregulated [PMC5769367]. The expression of SNORD114-11 can be detected using specific reverse transcription primers and universal primers [PMC5769367]. In omental tissues compared to ovarian cancer tissues (OC), the expression of MIAT is increased while the expression of SNORD114-2, SNORD114-10, and SNORD114-11 is decreased [PMC5769367]. Furthermore, in post-therapeutic locally advanced cervical cancer (LACC) samples compared to pretherapeutic LACC samples, the expression of several snoRNAs including SNORD116-4 and SNORD116-2 is upregulated while the expression of snoRNAs such as SNORAD1135 and 1138 is decreased [PMC6900565]. Additionally, several snoRNAs including SNORAD1135 and 1138 are identified as key regulators by co-expressing with more than 150 mRNAs [PMC6900565]. Overall these findings suggest that the dysregulation of snoRNAs such as downregulation of MIAT and upregulation or downregulation of various members of the C/D Box 144 cluster including specifically downregulation or upregulation specifically for members such as MIAT or members such as MIAT or members such as MIAT or members such as MIAT or members such as MIAT or members such as MIAT or members such as MIAT or members such as MIAT or members such as MIAT or members such as MIAT or members such as MIAT or members such as MIAT or members such as MIAT or members such as SNORD114-11 may play a role in the development and progression of ovarian and cervical cancers [PMC8677010][PMC5769367][PMC6900565].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGACCAGUGAUGGUGACUGGUGGUGUGUGAGUCAUGCACAGUGAAUAUCAUGUGUCUGGAACUCUGAGGUCCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications