Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-523 precursor URS000068F03F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR523: MIR523 is a miRNA gene that is part of the C19MC miRNA gene cluster on chromosome 19 [PMC6193703]. In breast invasive carcinoma, the expression of MIR523 was not significantly different between the CAA and control groups when using a variable threshold, but became significantly different when using a fixed threshold [PMC7157974]. Additionally, MIR523 was close to being significantly different in other analyses [PMC7157974]. However, the targets for MIR523 and other miRNAs in the C19MC cluster could not be predicted due to limited available sequences in databases [PMC2394755]. In hepatocellular carcinoma (HCC), the expression of MIR523 and other C19MC miRNA genes was analyzed using TCGA miRNA-seq dataset and matched to HCC-iCluster RNA-seq data set to create an integrated dataset [PMC7378193]. Furthermore, MIR523 is part of a subset of miRNAs on chromosome 19 that have been associated with stem cell biology and tumorigenesis [PMC8508841]. References: - [PMC6193703]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6193703/ - [PMC7157974]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7157974/ - [PMC2394755]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2394755/ - [PMC7378193]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7378193/ - [PM8508841]: https://www.ncbi.nlm.nih.gov/pmc/articles/PM8508841/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUCAUGCUGUGACCCUCUAGAGGGAAGCGCUUUCUGUUGUCUGAAAGAAAAGAACGCGCUUCCCUAUAGAGGGUUACCCUUUGAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications