Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-582 precursor URS000068CA2F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR582: MIR582 is a microRNA that is upregulated in various types of adenoma clusters, including the ACTH adenoma group, the CNFPA cluster, and the GH, TSH, and PRL adenoma cluster [PMC10032474]. It is also found in the monocot lineage [PMC4723133]. The length of MIR582 varies depending on the cell line, with a length of approximately 1.55 Mb in the GM12878 cell line and 765 kb in the UML49 cell line [PMC6824518]. MIR582 has been found to play a role in enhancing epithelial-mesenchymal transition (EMT) by activating the Wnt-β-catenin pathway [PMC7602903]. Targeting MIR582 could disrupt this regulatory network maintained by Wnt pathway genes [PMC9517164]. Upregulated expression of MIR582 has been observed in cancer stem cells (CSCs) from a non-small-cell lung cancer (NSCLC) cell line A549 and has been associated with amplification of the MIR582 gene locus in lung cancer cell lines [PMC9517164] [PMC4667703]. Additionally, MIR582 is included among several other microRNAs found in Emca3 that encode small RNAs [PMC4132170] [PMC8583574]. In summary, MIR582 is an upregulated microRNA that plays a role in various adenoma clusters and has been associated with EMT and CSCs. It also varies in length depending on the cell line and has been found to be amplified in lung cancer.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUCUGUGCUCUUUGAUUACAGUUGUUCAACCAGUUACUAAUCUAACUAAUUGUAACUGGUUGAACAACUGAACCCAAAGGGUGCAAAGUAGAAACAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

Publications