Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 125 (SNORD125) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 125 (SNORD125) URS000068C891_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD125: SNORD125 is a small nucleolar RNA (snoRNA) that has been reported in several studies [PMC7738477]. It is worth mentioning that SNORD125 is annotated as miR-3653 [PMC7738477]. In a study, an increase in the methylation status of 18S-Cm1440 was associated with higher levels of SNORD125 in SH-SY5Y differentiated FUS KO and FUS R495X cells [PMC9941101]. Furthermore, the curated coordinates of several snoRNAs, including SNORD125, differed significantly from their known annotation [PMC4914119]. The expression levels of SNORD125 and the methylation levels at SSU-C1440 varied considerably in DLBCLs [PMC8210301]. In DLBCLs, methylation at SSU-C1440 was guided by SNORD125, which is encoded within the AP1B1 gene [PMC8210301]. In summary, SNORD125 is a snoRNA that has been annotated as miR-3653. It has been found to be associated with changes in methylation status and expression levels in different cell types and diseases. The curated coordinates of several snoRNAs, including SNORD125, have been reported to differ from their known annotation. These findings highlight the importance of further research to understand the functional role of SNORD125 and its potential implications in various biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACCCCUGGCAGCCCCUCCUGAUGAUUCUUCUUCCUGAGCACGCUCAUGAUGAGCAAACUGAGCCUCUAAGAAGUUGACUGAAGGGGCUGCUUCCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

2D structure Publications