Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) snoRNA (ENSG00000221611.1) secondary structure diagram

Homo sapiens (human) snoRNA (ENSG00000221611.1) URS0000688170_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD88: SNORD88 is a small nucleolar RNA (snoRNA) that has been implicated in joint aging and osteoarthritis (OA) [PMC5333149]. In joint aging, SNORD88 was found to be significantly decreased in old equine cartilage and human-derived samples [PMC5333149][PMC6769748]. It was also observed that SNORD88 is not differentially expressed in sham versus DMM joint [PMC5333149]. SNORD88 belongs to the LSU snoRNA family and is involved in directing a modification in the H67 region of the 28S rRNA sequence [PMC4288182]. Additionally, genes within the SNORD88 family are associated with splicing regulation [PMC5454292]. In terms of functional effects, SNORD88 has been found to have a segment called the M-box, which displays high complementarity to endogenous pre-mRNA sequences [PMC7038934]. Knocking out endogenous SNORD88C or substituting it with mutated variants would provide a means to investigate the biological significance of M-boxes [PMC7038934]. Overall, snoRNAs such as SNORD88 have shown potential as novel biomarkers for joint aging and OA, highlighting their importance in understanding these conditions [PMC5333149][PMC6769748][PMC4288182][PMC5454292][PMC7038934].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACAUUCCAUGAUGUCCAGCACUGGGCUCUGAUCACUCCGGAGGACACAGUUUUCCCCAAGACCAUGGCUACCUGGGGAUCUGAGAGAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Gorilla gorilla gorilla snoRNA (ENSGGOG00000029936.2)
2D structure Publications