Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 1C (ENSG00000274091.1) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 1C (ENSG00000274091.1) URS0000686085_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD1C: SNORD1C is a type of small nucleolar RNA that has been found to be highly expressed in ALDH+ tumor cells in non-small cell lung cancer (NSCLC) [PMC9010412]. This high expression of SNORD1C in ALDH+ tumor cells is associated with a poor prognosis [PMC9010412]. This suggests that SNORD1C may play a role in promoting malignant tumors and may be closely related to tumor cell self-renewal and cancer recurrence [PMC9010412]. In addition to NSCLC, the role and clinical significance of SNORD1C have also been studied in patients with colorectal cancer (CRC) [PMC8806983]. In these studies, SNORD1C expression was analyzed in serum samples from CRC patients using qRT-PCR, and its clinical implication was evaluated in combination with CEA (carcinoembryonic antigen) levels in the blood [PMC8806983]. Furthermore, experiments using SW620 cells with stable transfer of sh-SNORD1C and HCT116 cells overexpressing SNORD1C were conducted to study the effects of altering SNORD1C expression on sphere formation [PMC9010412]. These studies provide insights into the role of SNORD1C in different types of cancer and its potential as a biomarker for prognosis and treatment response.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGAGCUGAGGAUGAUUUAAAGUUAUCCCUGUCUGAAAUGGUAUCUUUUGUGAGGAGGUCUGACUUGCUGAGGCUCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications