Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) snoRNA (ENSG00000212229.1) URS000068066E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD65: SNORD65 is a small nucleolar RNA (snoRNA) that has been found to be involved in various biological processes. It has been shown that immune-activating or inhibiting stimuli applied to primary DCs can increase the levels of SNORD65 within extracellular vesicles (EVs) [PMC10050728]. However, SNORD65 is not considered a stable reference gene for miRNA normalization [PMC6883285]. In certain conditions, such as in scERĪ±KO satellite cells and hepatocellular carcinoma, the expression of SNORD65 is dysregulated [PMC6655560] [PMC9818347]. SNORD65 has also been reported to be upregulated in relapsed BCP-ALL patients compared to patients without relapse [PMC9413531]. Additionally, SNORD65 has been found to be associated with certain molecular panels and coping behavior in different contexts [PMC8417057] [PMC7461500]. It is worth noting that the expression levels of SNORD65 can be normalized using other small noncoding RNAs such as Rnu6, Snord68, Snord87, and Rny1 for more stable reference gene normalization [PMC3184962]. Overall, these findings highlight the diverse roles and dysregulation of SNORD65 in various biological processes and diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAACGAUGAACUCACCUAAAAUAGCUGUAAUAACCAGCAGAUUAUGUAAUGGCAAACCUACAGUUUUCUGAAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications