Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-920 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-920 precursor URS000067E0B9_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-920: Hsa-mir-920 is a microRNA that was identified as a possible target for IL-1β in patients with GA. This finding was based on a combination of bioinformatic prediction and miRNA array analysis [PMC5602958]. In addition to hsa-mir-920, four other microRNAs (hsa-miR-30c-1-3p, hsa-miR-488-3p, hsa-miR-550a-3p, and hsa-miR-663a) were also found to potentially target IL-1β and were decreased in the white blood cells of GA patients [PMC5602958]. Hsa-mir-920 is associated with autophagy and targets the autophagy gene ATG9B [PMC9781133]. Other autophagy genes such as ATG12, BECN1, and SESN1 are targeted by different microRNAs (hsa-miR-3064-3p, hsa-miR3675.3p, hsa-miR4797.3p, and hsa-mir6715b.3p) as predicted by Ingenuity Pathway Analysis (IPA) software [PMC9781133]. These findings suggest that dysregulation of microRNAs targeting IL1β and autophagy genes may play a role in the pathogenesis of GA. Further research is needed to elucidate the specific mechanisms involved [PMC5602958] [PMC9781133].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUAGUUGUUCUACAGAAGACCUGGAUGUGUAGGAGCUAAGACACACUCCAGGGGAGCUGUGGAAGCAGUAACACG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Gorilla gorilla gorilla microRNA 920 (ENSGGOG00000028872.2)
2D structure Publications