Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) scRNA (ENSG00000251805.1) secondary structure diagram

Homo sapiens (human) scRNA (ENSG00000251805.1) URS000067D1FB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SCARNA21: SCARNA21 is a computationally predicted H/ACA box snoRNA that contains conserved C and D box elements and is enclosed by a terminal stem structure [PMC4053766]. The elongated isoform of SCARNA21, which is an H/ACA box snoRNA embedded in a C/D box snoRNA, was found to have three additional functional ASEs [PMC4914119]. These findings suggest that SCARNA21 plays an important role in the maturation of snRNAs of the minor spliceosome [PMC4914119]. The sequence inferred from small RNA sequencing data for SCARNA21, SNORD11B, and SNORA58 differed considerably from the sequence defined by the HGNC [PMC4914119]. In samples from patients with type 1 diabetes (T1D), SCARNA21 was found to be up-regulated compared to non-diabetic (ND) samples, while 10 other genes were down-regulated in T1D samples [PMC5952354].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGCAUGAUUUCCUGCAGGUUGAGCUCAGCCAAGUACCACCCCUCAGUAAGCCUAGAGUAGAGGGGCCUGACAUCCUUUCCUUAAAUUAAACAAGGAGCCUUAUCCAGGUUGUCCUAGUCUCAUACUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications