Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-891b precursor URS0000676F0F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-891b: Hsa-mir-891b is a microRNA that has been studied in various contexts [PMC4229095]. It has been found that SNP rs4687554 tags the hsa-mir-891b binding site SNP rs6445538 of MUSTN1, and rs3134615 is located at the binding site of hsa-miR-1827 of MYCL1 [PMC4229095]. In BRCA1 mutant cell lines, hsa-miR-29b and hsa-mir-891b were the two most highly expressed miRNAs [PMC3672661]. Hsa-mir-891b was also predicted to be a target miRNA of hsa-circRNA_100918 [PMC5544722]. In a study analyzing microRNAs, it was found that hsa-mir-891b had an R2 value of 0.9312, indicating a sensitive and optimal amplification efficiency [PMC9073789]. Hsa-mir-891b was further identified as one of the 12 microRNAs with potential significance based on expression levels and patterns [PMC9073789]. It was also found to be downregulated in certain contexts, along with other miRNAs such as hsa-miR-891a-5p and hsa-miR-892a [PMC8948606]. Finally, in a Venn diagram analysis, it was shown that hsa-mir-891b overlaps with other predicted miRNAs such as hsa-miR-548k and hsa-miR-140-3p [PMC7867743].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUUAAUCCUUGCAACUUACCUGAGUCAUUGAUUCAGUAAAACAUUCAAUGGCACAUGUUUGUUGUUAGGGUCAAAAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

Publications