Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 113-3 (SNORD113-3) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 113-3 (SNORD113-3) URS00006762EA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD113-3: SNORD113-3 is a small nucleolar RNA (snoRNA) that is upregulated in post-therapeutic LACC samples compared to pre-therapeutic LACC samples [PMC9267054]. It is also found to be upregulated in acute promyelocytic leukemia (APL) compared to other types of hematologic tumors [PMC8629011]. SNP rs2400963 is located in the SNORD113-3 gene [PMC6202974]. In lymph node-positive invasive ductal carcinoma (LN+ IDC), SNORD113-3 is both deleted and downregulated compared to normal adjacent tissue [PMC8259224]. In a study of triple-negative breast cancer (TNBC) patients, SNORD113-3, along with other genes, showed corresponding changes in gene expression and were assessed for their prognostic value [PMC8259224]. However, no survival information was available for the deleted SNORD113-3 gene [PMC8259224]. In addition, the expression of SNORD113-3 was found to be significantly downregulated in a study on Dlk1 expression and other microRNAs in hepatocellular carcinoma [PMC4169825]. References: [PMC9267054] [PMC8629011] [PMC6202974] [PMC8259224] [PMC4169825]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGACCAAUGAUGAGUAUUCUGGGGUGUCUGAAUCAAUGAUUUUGAUUAAACCCUGUAACUCUGAGGUCCAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications