Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) Small nucleolar RNA SNORD115 (ENSG00000212411.1) secondary structure diagram

Homo sapiens (human) Small nucleolar RNA SNORD115 (ENSG00000212411.1) URS0000674E65_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD115: SNORD115 and SNORD116 are snoRNAs that have been implicated in the pathogenesis of Prader-Willi syndrome and schizophrenia [PMC6937981]. SNORD115 is part of the UBE3A-ATS transcript, which also contains SNORD109B and extends to overlap the UBE3A gene [PMC4171697]. Other snoRNAs in this region include SNORD64, SNORD107, SNORD109A, and SNORD116 [PMC3137005]. A radiolabeled riboprobe was used to probe for SNORD115 and SNORD116 in Hg19 [PMC3656643]. PWS patients lack the locus 15q11.2–q13.1 that contains six snoRNAs, including SNORD107, SNORD64, and SNORD115 [PMC7140444]. While the role of spliced lncRNA 116HG has not been investigated, it is known that SNORD115 regulates alternate splicing of a serotonin receptor [PMC3792690]. Mouse models have shown that ectopic expression of SNORD115 in the choroid plexus leads to a double-stranded structure formation with 5-Ht2cr pre-mRNA [PMC8037846]. There are a total of 393 snoRNA sequences, including members of the multi-copy gene families such as SNOD113, SNOD114, SNO114, SNO114, SNO114, SNO114, SNO114, SNO114, SNO1134, and SNO1136 [PMC4914119]. Hypermethylation was found in regions on both SNOD115 and SNO1136 in affected individuals [PMC7522197]. Engineered expression of members of SNOD115 in brain tissues other than brain parenchyma has been reported [PMC9382696]. Moreover, aberrant expression of SNOD115 and SNO1136 was found in a subgroup of MM patients [PMC9413531]. In transgenic mice lacking SNOD115 expression, increased editing but no changes in splicing profile of 5ht2c pre-mRNA were initially found, but a later analysis revealed a higher proportion of short splice isoform in the hypothalamus [PMC5865145]. Five additional alternative splicing targets of SNOD115 were also identified [PMC8508363].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGCCAAUGCUGAAUUAUUAUCUUGACGAGAAAUGAUGACGUAAAAAUUAAGCUUAGUAGGAUUACACUGAGGCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

2D structure Publications