v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) tRNA-Pro (anticodon CGG) 2-1 (TRP-CGG2-1) secondary structure diagram

Homo sapiens (human) tRNA-Pro (anticodon CGG) 2-1 (TRP-CGG2-1) URS00006744D5_9606

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGCUCGUUGGUCUAGGGGUAUGAUUCUCGCUUCGGGUGUGAGAGGUCCCGGGUUCAAAUCCCGGACGAGCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 24 other species

  1. Albula glossodonta tRNA-OTHER
  2. Alligator mississippiensis tRNA-Pro (CGG) (tRNA-Pro-CGG-3-1)
  3. Aphidius gifuensis tRNA-Pro
  4. Canis lupus familiaris tRNA-Pro (CGG) (tRNA-Pro-CGG-2-1)
  5. Danio rerio tRNA-Pro (CGG) (tRNA-Pro-CGG-3 1 to 34)
  6. Dermacentor andersoni (Rocky Mountain wood tick) transfer RNA proline (anticodon CGG)
  7. Glossina austeni tRNA tRNA-Pro
  8. Glossina brevipalpis tRNA tRNA-Pro
  9. Glossina fuscipes fuscipes tRNA
  10. Glossina morsitans morsitans tRNA tRNA-Pro
  11. Glossina pallidipes tRNA tRNA-Pro
  12. Glossina palpalis gambiensis (Tsetse fly) tRNA tRNA-Pro
  13. Hyalomma asiaticum tRNA-Pro for anticodon CGG
  14. Merluccius polli tRNA-Pro
  15. Musca domestica (House fly) tRNA MDOA002287
  16. Ornithorhynchus anatinus tRNA-Pro (CGG) (tRNA-Pro-CGG-2-1)
  17. Pangasianodon gigas tRNA-Pro
  18. Rhipicephalus sanguineus transfer RNA proline (anticodon CGG)
  19. Salmo salar tRNA
  20. Schistocerca gregaria (Grasshoppers) transfer RNA proline (anticodon CGG)
  21. Schistocerca serialis cubense (Grasshoppers) transfer RNA proline (anticodon CGG)
  22. Stomoxys calcitrans tRNA-Pro
  23. Xenopus tropicalis tRNA-Pro (CGG) (tRNA-Pro-CGG-2-1, tRNA-Pro-CGG-2-2)
  24. Xiphophorus maculatus (southern platyfish) tRNA
 2D structure Publications