Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) snoRNA (ENSG00000252170.2) secondary structure diagram

Homo sapiens (human) snoRNA (ENSG00000252170.2) URS000067445B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD112: SNORD112 is a C/D box small nucleolar RNA (snoRNA) that is part of a cluster of snoRNAs transcribed from the DLK1-DIO3 locus on human chromosome 14 (14q32) [PMC8976432]. The cluster includes SNORD113 1-9 and SNORD114 1-31 [PMC8976432]. SNORD112, along with some members of the SNORD113 family, is located in the intron of the MEG8 gene [PMC5641212]. It has been found that SNORD112 is ectopically expressed in acute promyelocytic leukemia (APL) [PMC6202974]. The expression of SNORD112 has also been observed in idiopathic membranous nephropathy and in post-therapeutic samples from patients with locally advanced cervical cancer (LACC) [PMC7441435] [PMC6900565]. Additionally, differential expression levels of SNORD112 have been identified when comparing relapsed and non-relapsed patients with acute myeloid leukemia (AML) [PMC7167781]. The association between CBs (Cajal bodies) and snoRNA genes, including SNORD112, has been investigated in HeLa cells, suggesting that CBs play a role in genome organization [PMC4802181]. It has also been observed that some variants of SNORD115 and SNORD116 snoRNA families have different expression patterns and putative targets in multiple myeloma (MM) [PMC3511933]. Furthermore, studies have shown that ectopic expression of certain snoRNAs from the DLK1-DIO3 locus can inhibit cell growth through specific signaling pathways, such as the retinoblastoma gene/p16 pathway [PMC5769367].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGACCAAUGAUGAGAGCAUGUCACAAAACAAGGCUUAUGAUUAAUCCAGUUCUGUACACCUGAGGUCCAAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

2D structure Publications