Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 14C (SNORD14C) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 14C (SNORD14C) URS000066E3F5_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD14C: SNORD14C is a small nucleolar RNA (snoRNA) that has been implicated in various types of cancer, including laryngeal carcinoma and melanoma. In laryngeal carcinoma, elevated levels of SNORD14C have been associated with a higher risk of cancer development and have been suggested as a prognostic marker for high-risk squamous cell carcinomas of the larynx [PMC3356733] [PMC5386677]. However, the exact role of SNORD14C in melanoma progression is still unknown [PMC4699850]. SNORD14C has been found to be down-regulated in melanoma, suggesting a potential role in the molecular mechanisms of melanoma progression [PMC4699850]. Additionally, SNORD14C has been shown to be highly expressed compared to its host gene Hspa8 at certain times of the day [PMC5454292]. In protein-protein network analysis, SNORD14C was found to interact with amyloid-β precursor protein (APP), suggesting a potential involvement in neurodegenerative diseases such as Alzheimer's disease [PMC6892907]. Furthermore, SNORD14C is part of a four-gene classifier that predicts shorter relapse-free survival in laryngeal cancer patients and identifies those at high risk for recurrence [PMC8677010]. Finally, six snoRNAs including SNORD14C have been found to have miRNA-like functions, suggesting their involvement in post-transcriptional gene regulation [PMC5814818].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCGCUGUGAUGAGUGAUUGUUAAACAUUCGUAGUUUCCACCAAAAGCUUGGCUAAUGAUGGCAACACCUUCCUUGGAUGUCUGAGCGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

2D structure Publications