Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-584 precursor URS000066A55E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR584: MIR584 is a microRNA that has been found to be upregulated in the liver [PMC4482373]. It is also involved in pancreatic neuroendocrine tumors (pNETs) and pancreatic ductal adenocarcinoma [PMC9554633]. Other miRNAs identified in pNETs include miR1285, miR550a-5P, and miR1825 [PMC9554633]. In the context of H. pylori-induced inflammation and gastric carcinogenesis, let-7b, miR-103, miR-370, and miR-371-5p are downregulated, while miR-21, miR-25, and MIR584 are upregulated [PMC5081003]. MIR584 has been shown to regulate ovarian cancer progression by targeting lipin-1 [PMC8122924]. Low levels of MIR584 are associated with increased metastasis spreading and poor prognosis in ovarian cancer [PMC8122924]. Depletion of MIR584 expression in ovarian cancer cells leads to increased lipin-1 expression and tumorigenesis [PMC8122924].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGGGUGACCAGCCAUUAUGGUUUGCCUGGGACUGAGGAAUUUGCUGGGAUAUGUCAGUUCCAGGCCAACCAGGCUGGUUGGUCUCCCUGAAGCAAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

Publications