Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 45C (ENSG00000206620.1) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 45C (ENSG00000206620.1) URS0000668E0B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD45C: SNORD45C is a guide snoRNA that mediates modifications in mRNA translation [PMC9412354]. Knockout of SNORD45C in HeLa cells resulted in changes in translation of specific subsets of mRNAs, either decreasing or increasing their levels [PMC9412354]. Interestingly, SNORD45C was found to be up-regulated under MYC overexpression [PMC8393311]. The mRNAs that were up- or down-regulated upon SNORD45C depletion showed variations in elongation-related codon compositions, suggesting that translational defects caused by SNORD45C depletion might depend on ORF sequences and codon usage [PMC8393311]. Knockout of SNORD45C and the resulting loss of 2′Ome at 18S-Cm174 led to translational deregulation of numerous specific mRNAs involved in cell cycle, mitosis, metabolism, and intracellular transport [PMC8393311]. SNORD45C was found to have two strong regions for target binding upstream of the boxes D’ and D [PMC9226514]. Knockout of SNORD45C resulted in decreased translation of a specific set of mRNAs involved in cell division, while global translation remained unaffected [PMC9941101]. The expression levels of SNORD45C showed no significant difference between coronary AS patients and healthy patients [PMC9046892]. However, the levels of UBE2G2, SNORD45A, SLC16A3, POLR2C, PNO1, CEMP1, AMDHD2 were significantly higher in plaques from coronary AS patients compared to adjacent intima [PMC9046892]. The expression levels UBE2G2, SNORD45A/B/C , RABGGTB , SLC16A3 , POLR2C , PNO1 , CEMP1 , AMDHD2 were measured using RT-qPCR [PMC9046892].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUCAAUGAUGAGUUGGCAUGUAUUCUGAAUCUAAAGUUGAUUAUUACUACUUUAGCUCUAGAAUUACUCUGAGACCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications