Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-638 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-638 precursor URS0000668846_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-638: Hsa-mir-638 is a microRNA that has been studied in various contexts. In one study, a decrease in the methylation levels of hsa-mir-638 was not observed in cells treated with 5-Aza, unlike other microRNAs such as hsa-miR-149, hsa-miR-203, and hsa-miR-375 [PMC4055305]. Another study found aberrant expression of hsa-mir-638 in the PBMCs of lupus nephritis patients [PMC4463604]. Hsa-mir-638 has also been found to target LDLR and is associated with its mRNA expression [PMC8782054]. In different studies, hsa-mir-638 was found to be upregulated in various contexts such as cancers and TNBC [PMC7690852] [PMC5859742] [PMC7499949]. Conversely, it was also found to be downregulated in other contexts such as stomach adenocarcinoma tissues [PMC3732277]. Hsa-mir-638 has been shown to have antiviral activity against HBV and predicted target genes related to rabies virus NP genes [PMC4416288] [PMC3521223]. Additionally, it has been implicated in cell migration by targeting Nor1 [PMC6471025]. These studies highlight the diverse roles and expression patterns of hsa-mir-638 across different diseases and biological processes.

MIR638: MIR638 is a microRNA that is significantly downregulated in human aortic vascular smooth muscle cells (vSMCs) during their proliferation and migration induced by PDGFbb [PMC7123062]. It has been found to hinder vSMC proliferation by targeting the nuclear receptor NR4a3 (NOR1) and impeding cyclin-D1 production [PMC7123062]. In hepatocellular carcinoma (HCC), the levels of MIR638 are increased, suggesting its role as a tumor suppressor [PMC3471083]. MIR638 has also been identified as one of the microRNAs that can differentiate between a good or poor prednisone response in pediatric acute lymphoblastic leukemia (ALL) [PMC8645370]. It has been shown to be involved in regulating tumor-related genes and repressing Toll-like receptor expression, thereby reducing inflammation caused by excessive mitochondrial DNA transfer [PMC5058711] [PMC8548694]. MIR638 is found in exosomes and its expression is altered in various diseases, including cardiovascular diseases and cancer. In cardiovascular diseases, its downregulation is associated with vSMC proliferation, while in cancer it may serve as a tumor suppressor. Additionally, MIR638 can be detected in plasma samples and may have diagnostic potential for certain diseases [PMC8408408] [PMC5573355].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGAGCGGGCGCGGCAGGGAUCGCGGGCGGGUGGCGGCCUAGGGCGCGGAGGGCGGACCGGGAAUGGCGCGCCGUGCGCCGCCGGCGUAACUGCGGCGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications