Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 70B (ENSG00000212309.1) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 70B (ENSG00000212309.1) URS0000666DC3_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD70: SNORD70 is a small nucleolar RNA (snoRNA) that has been identified as a transcript candidate based on read coverage peaks and annotation track analysis [PMC4682413]. It has been found to have overlapping binding sites with snoRD11 and snoRD56 on the 18S rRNA [PMC5612246]. SNORD70 is also known as HBII-234 and has been stably expressed across different tissues in mice [PMC6883285]. It has been used as an internal control in gene expression studies, such as in the assessment of miRNA expression levels [PMC7267729] and in qPCR-based assays [PMC7568261]. SNORD70 is involved in early ribosome biogenesis and dissociates before separation of the ribosomal subunits, indicating its role in early stages of ribosome maturation [PMC4288182]. It is one of the snoRNAs that function in early ribosome biogenesis, along with SNORD14, SNORD100, and SNORD20 [PMC4288182]. The curated coordinates for SNORD70 have been found to differ significantly from its known annotation [PMC4914119]. In addition to its role as a normalization control, SNORD70 has also been found to be expressed in a tissue-biased manner [PMC7568261].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCAAUGUUGUCAAUGAUGCAUUCUUAUUGGAACUGAAUUUAAGUGAUCUGACUCAUUCGUCACUACCACUGAGACAACAUUGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

2D structure Publications