Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-519d precursor URS00006656A0_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR519D: MIR519D is a microRNA that has been studied in various contexts, including hepatocellular carcinoma (HCC) [PMC5074303], central nervous system (CNS) tumors [PMC8235499], non-alcoholic fatty liver disease (NAFLD) [PMC9775974], and breast invasive carcinoma [PMC6193703]. In HCC, MIR519D has been shown to target TIMP2, a member of the TIMP family that regulates the activity of MMP2 [PMC5074303]. However, in hypoxic HCC cells, MIR519D up-regulation was not observed [PMC5074303]. Interestingly, MIR519D is overexpressed in the majority of CNS tumors [PMC8235499]. In NAFLD, MIR519D is elevated and directly targets PPARĪ± mRNA [PMC9775974]. In HCC tumorigenesis, MIR519D has been validated to play a specific role [PMC6338110]. It is also associated with stem cell biology and tumorigenesis [PMC8508841]. Additionally, MIR519D expression has been found to be increased in adipogenesis-promoting cells but decreased in another subtype [PMC6307768]. Furthermore, little to no expression of MIR519D was observed at the RNA level in patients with certain pathologies [PMC9623263]. Disruption of MIR519D has also been observed along with its target genes in certain individuals from different regions [PMC3938728]. Hypomethylation of the CpG island of miR-519d and miR-429 resulted in increased expression of MIR519D in HCC [PMC8904560]. Finally, based on module genes analysis, it was predicted that MIR106A, MIR106B, MIR20B, and MIR519D may be involved in certain diseases or conditions [PMC9208509].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCCAUGCUGUGACCCUCCAAAGGGAAGCGCUUUCUGUUUGUUUUCUCUUAAACAAAGUGCCUCCCUUUAGAGUGUUACCGUUUGGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications