Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-604 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-604 precursor URS0000664FAA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-604: Hsa-mir-604 is a primate-specific miRNA that has been found to be expressed in primates, including Homo sapiens [PMC9708597]. It has been shown to target Grin1 in Homo sapiens, as confirmed by a dual-luciferase reporter assay [PMC9708597]. Evolutionary analysis has revealed that novel-m009C may be homologous to hsa-mir-604 [PMC9708597]. The Luc/R-Luc ratio was significantly decreased when hsa-mir-604 was co-transfected with the Grin1 3’UTR, indicating its targeting ability [PMC9708597]. Hsa-mir-604 has been found to be upregulated in the prefrontal cortices of subjects with alcohol use disorders postmortem, suggesting its potential role in alcohol addiction [PMC9708597]. The role of hsa-mir-604 in drug addiction and human diseases is still not well understood and requires further research [PMC9708597]. Phylogenetic analysis has shown that hsa-mir-604 and novel-m009C are closely related evolutionarily [PMC9708597]. In addition, hsa-mir-604 has been identified as one of the hub miRNAs within a miRNA network associated with good prognosis, indicating its potential significance in disease prognosis [PMC8004706]. Hsa-mir-604 is also among the differentially expressed miRNAs associated with high-risk groups in certain diseases [PMC9695425]. Furthermore, hsa-mir-604 has been found to be overexpressed in paracoccidioidomycosis patients and may play a role in oxidative stress regulation and disease prognosis related to TLR4 and CXCL1 genes in acute myocardial infarction patients [PMC8863347].

MIR604: MIR604 is a type of maize event that has been analyzed using bioinformatic methods specified in EFSA GMO Panel (2011a) [PMC7009178]. These analyses have confirmed that MIR604 does not disrupt any known endogenous genes [PMC7009178]. Additionally, when animals were fed balanced diets containing maize Bt11 × MIR604 × 1507 × 5307 × GA21, their measured performance endpoints were similar to those of the control group [PMC7009178]. This suggests that the inclusion of MIR604 in the diet does not have a significant impact on animal performance [PMC7009178].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGAGCAUCGUGCUUGACCUUCCACGCUCUCGUGUCCACUAGCAGGCAGGUUUUCUGACACAGGCUGCGGAAUUCAGGACAGUGCAUCAUGGAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications