v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens microRNA mir-191 URS0000663EAF_9606

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGCUGGACAGCGGGCAACGGAAUCCCAAAAGCAGCUGUUGUCUCCAGAGCAUUCCAGCUGCGCUUGGAUUUCGUCCCCUGCUCUCCUGCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Chlorocebus sabaeus microRNA mir-191
  2. Gorilla gorilla gorilla microRNA mir-191
  3. Gorilla gorilla (western gorilla) microRNA mir-191
  4. Macaca fascicularis (crab-eating macaque) microRNA mir-191
  5. Macaca mulatta (Rhesus monkey) microRNA mir-191
  6. Nomascus leucogenys microRNA mir-191
  7. Pan troglodytes microRNA mir-191
  8. Papio anubis (Olive baboon) microRNA mir-191
  9. Pongo abelii microRNA mir-191
  10. Pongo pygmaeus microRNA mir-191
 Publications