Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 88C (ENSG00000220988.1) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 88C (ENSG00000220988.1) URS00006611EB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD88C: SNORD88C, also known as HBII-180C, is a box C/D small nucleolar RNA (snoRNA) that is processed into shorter fragments called small nucleolar RNA-derived RNAs (sdRNAs) [PMC4851398]. These sdRNAs have been shown to have complementarity to fibroblast growth factor receptor-3 (FGFR3) pre-mRNA [PMC4427830]. SNORD88C can influence the alternative splicing of FGFR3 pre-mRNA, leading to changes in the splicing pattern of FGFR3 [PMC7038934]. It has been demonstrated that SNORD88C sdRNAs can suppress the expression of target genes in a sequence-dependent manner through base pairing with pre-mRNA regulatory elements [PMC4427830]. The snoMEN vectors, which are derived from modified versions of snoRNAs like SNORD88C, have been developed as a novel technology for gene expression modulation and can be used for the generation of stable cell lines with targeted protein replacement [PMC4696412]. SNORD88C has also been shown to have base complementarity to intronic regions of FGFR3 and other pre-mRNAs, suggesting its involvement in splicing regulation [PMC8508363]. Additionally, SNORD88C sdRNAs may be involved in regulating mRNA splicing for FGFR3 and other genes through their interaction with target regions [PMC8389557]. The specific involvement and function of sdRNAs derived from SNORD88C are still being investigated [PMC8508363].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGCUCCCAUGAUGUCCAGCACUGGGCUCUGAUCACCCCUGAGGACACAGUGCACCCCAGGACCUUUGACACCUGGGGGUCUGAGGGGCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Callithrix jacchus snoRNA (ENSCJAG00000072160.1)
2D structure Publications