Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) small nucleolar RNA, C/D box 49B (ENSG00000277108.1) URS0000660E95_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD49B: SNORD49B is a C/D box snoRNA sequence that is part of the lncRNA LNC-SNO49AB, which also contains the snoRNA sequence SNORD49A [PMC9622897]. SNORD49B is located in the middle of LNC-SNO49AB, with SNORD49A at the 3' end [PMC9622897]. Deletion of conserved motifs in SNORD49B did not affect the generation of LNC-SNO49AB [PMC9622897]. When both SNORD49A and SNORD49B domains were deleted from LNC-SNO49AB, it could no longer interact with FBL [PMC9622897]. Both SNORD49A and SNORD49B are located in the second intron of the noncoding gene SNHG29 on chromosome 17 [PMC9622897]. The DNA sequence of LNC-SNO49AB is conserved among primates and also in mice [PMC9622897]. The expression of both SNORD49A and SNORD4B has been shown to be abnormal in leukemia, leading to investigation into the potential role of LNC-SNO4B9AB in leukemia [PMC9622897]. RNA immunoprecipitation assays demonstrated that FBL could bind to LNC-SNO4B9AB, similar to its binding to SNOR4D9A and SNOTD4D9B, while lncRNA transcribed by its host gene did not show FBL binding enrichment [PMC9622897].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUCCUGAUGAUACUUGUAAUAGGAAGUGCCGUCAGAAGCGAUAACUGACGACGUCUAAUGUCUAUCUGACC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications