Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 53 (SNORD53) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 53 (SNORD53) URS000065DBA2_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD53: SNORD53 is a small nucleolar RNA (snoRNA) that is expressed in various tissues, including lymphoid tissues, testes, neurons, and cancer cells [PMC7568261] [PMC8178906] [PMC8522698] [PMC8629011] [PMC5747948]. It belongs to the SNORD53/92 family and is encoded in the same host gene as SNORD92 [PMC8178906]. SNORD53 shows differential expression across tissues, with varying levels of expression in different organs such as muscle, liver, testis, brain, prostate, breast, and ovary [PMC8178906]. It has been found to interact with 28S rRNA and correlate with specific hypomethylated positions in the rRNA sequence [PMC8522698]. In cancer cells with high leukemia stem cell content (AML1-ETO+ samples), SNORD53 is strongly expressed along with other snoRNAs such as SNORD14D, SNORD14E, SNORD20, SNORD32A, SNORD34, SNORD35A, SNORD43 and SNORA74A [PMC8629011]. In addition to its role in RNA modification and cancer cells' gene expression regulation. It has also been found to be upregulated in adrenal and pancreatic tissues of a specific mouse strain (KK/HlJ) along with other genes involved in metabolic regulation and RNA processing such as VNN1 (vanin1), GPT2 (glutamic pyruvate transaminase 2), RPL30 (ribosomal protein RPL30), SCARNA22 (small Cajal body-specific RNA 22) among others. Furthermore it has been found that FBL association with snoRNAs guides such as FBL-SNORA56-SNORA53 targeting modification of 18S-Gm995 was not affected upon TFIP11 depletion [PMC7953684] [PMC8599867].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUGCUAUGAUGACAUCCAUAUGGUUUCGCUGCUGGCUGAGUUUCAGAGAUGACACCUUUCUCUUGGCUGUCUGAGCAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

2D structure Publications