v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens microRNA mir-146 URS000065B202_9606

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUGUAUCCUCAGCUUUGAGAACUGAAUUCCAUGGGUUGUGUCAGUGUCAGACCUGUGAAAUUCAGUUCUUCAGCUGGGAUAUCUCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Chlorocebus sabaeus microRNA mir-146
  2. Fukomys damarensis (Damara mole-rat) microRNA mir-146
  3. Gorilla gorilla gorilla microRNA mir-146
  4. Heterocephalus glaber (naked mole-rat) microRNA mir-146
  5. Macaca mulatta (Rhesus monkey) microRNA mir-146
  6. Nomascus leucogenys microRNA mir-146
  7. Otolemur garnettii microRNA mir-146
  8. Pan troglodytes microRNA mir-146
  9. Papio anubis (Olive baboon) microRNA mir-146
 Publications