Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 11B (ENSG00000271852.1) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 11B (ENSG00000271852.1) URS0000653FA4_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD11B: SNORD11B is a member of the small nucleolar RNA (snoRNA) family that is up-regulated in certain conditions [PMC4315415]. It is one of the genes that showed similarity to high let-7a-2–3p expressers [PMC4315415]. SNORD11B is a C/D snoRNA, which is a type of snoRNA that guides the modification of ribosomal RNA [PMC6294694]. The sequence inferred from small RNA sequencing data for SNORD11B differs considerably from the sequence defined by the HGNC [PMC4914119]. SNORD11B is one of several snoRNAs for which the curated coordinates differ significantly from their known annotation [PMC4914119]. In certain clusters, genes sharing a common function were predominant, including upregulated genes coding for small nuclear RNAs (snRNAs) such as SNORD11B [PMC4914119]. In acute myeloid leukemia patients, low expression of miR-188-5p was associated with up-regulation of FOSB, as well as SNORD50A, SNORD105, and SNORD11B [PMC4867976].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAUGGCAAUGAUGAUUUUUACACUUAUUGUUGUUCACCUGAUAACAUAAAUAUGAGGGUGUUCAGUCACUACCUCAUCUGAUGCCAUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

2D structure Publications