Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-586 precursor URS0000652679_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-586: Hsa-mir-586 is a microRNA (miRNA) that is part of a miRNA-mRNA network constructed using Cytoscape, which includes 44 mRNAs and 22 miRNAs [PMC9676937]. Hsa-mir-586, along with hsa-miR-571, hsa-miR-151b, hsa-miR-378i, hsa-miR-6727-5p, hsa-miR-502-3p, and hsa-miR-6798-3p, has been shown to be important for colorectal cancer carcinoma metastasis [PMC8794677]. The expression levels of hsa-mir-586 were extracted from RNA-seq and miRNA-seq data for calculating the TPM score [PMC8794677]. Hsa-mir-586 has been associated with the basal subtype of cancer and the drug Paclitaxel [PMC6504094]. Additionally, it has been associated with the basal and luminal subtypes for the drug Docetaxel [PMC6504094]. Hsa-mir-586 is one of six miRNAs that were found to be upregulated after RT-qPCR verification in a study on colorectal cancer [PMC6267312]. Furthermore, it has been identified as one of 15 miRNAs that can bind to seven out of eight circRNAs as competing endogenous RNAs (ceRNAs) in cancer cells [PMC8351580].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUGGGGUAAAACCAUUAUGCAUUGUAUUUUUAGGUCCCAAUACAUGUGGGCCCUAAAAAUACAAUGCAUAAUGGUUUUUCACUCUUUAUCUUCUUAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications