Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-518e precursor URS0000651BF7_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-518e: Hsa-mir-518e is a miRNA that has been found to be upregulated in pancreatic ductal adenocarcinoma (PDAC) tissues compared to adjacent normal controls [PMC5649611]. It is one of the 12 miRNAs that are upregulated in PDAC tissues, along with hsa-miR-10b, hsa-miR-575, hsa-miR-159a, hsa-miR-644, hsa-miR-581, hsa-miR-637, hsa-miR-935, hsa-miR-98, hsa-miR-513-3p, hsa-mir-518e (hsa) [PMC5649611]. Additionally, it has been found to be significantly dysregulated in 9 comparisons [PMC4268797]. In a study comparing neural stem cells (NSC) and induced pluripotent stem cells (iPSC), the expression of hsa-mir-518e was highly decreased in NSC cells compared to iPSC [PMC6696086]. This suggests that it may be a negative regulator of neural differentiation from iPSC [PMC6696086]. Furthermore, it has been identified as one of the miRNAs characteristic for the transition from iPSC to NSC along with other miRNAs such as mir-302 family and let7 family [PMC6696086]. In hepatocellular carcinoma (HCC), both hsa-mir518e and its homologue hsa-mir518b have been found to be upregulated [PMC5937522].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUCAGGCUGUGACCCUCUAGAGGGAAGCGCUUUCUGUUGGCUAAAAGAAAAGAAAGCGCUUCCCUUCAGAGUGUUAACGCUUUGAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications