Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-651 precursor URS0000651B6D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR651: MIR651 is a microRNA that is deleted in certain genetic conditions, such as DGDP289B, and is also positively correlated with the development of hepatocellular carcinoma (HCC) [PMC3929543] [PMC7019335] [PMC9495750]. The variant allele (C) of rs149259359 may disrupt binding sites for several miRNAs, including MIR651 [PMC6969370]. In a patient with a genetic disorder, a copy number gain at Xp22.31 encompassed the MIR651 gene [PMC4498854]. MIR651 is one of several miRNAs that positively correlated with serum IP10 and MCP-1 levels and were more commonly observed in individuals who developed HCC [PMC9495750]. In addition to HCC development, MIR651 has been found to have intimate interactions with other miRNAs such as MIR193A, MIR140, MIR214, MIR34A, and MIR130A [PMC6714963]. Overall, the research suggests that MIR651 plays a role in genetic conditions and HCC development.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAUCUAUCACUGCUUUUUAGGAUAAGCUUGACUUUUGUUCAAAUAAAAAUGCAAAAGGAAAGUGUAUCCUAAAAGGCAAUGACAGUUUAAUGUGUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Publications