Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-129 precursor (hsa-mir-129-2) secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-129 precursor (hsa-mir-129-2) URS00006515A6_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR129-2: MIR129-2 is a microRNA that has been studied in various types of cancer, including Diffuse Intrinsic Pontine Glioma (DIPG) [PMC4494928]. In order to validate the role of MIR129-2 in targeting NG2 in human DIPG, primary DIPG lines (SF8628) were used [PMC4494928]. The association between MIR129-2 methylation and other tumor suppressive microRNA methylation, such as MIR34A, MIR124-1, MIR203, and MIR196B, was examined in patients with Multiple Myeloma (MM), Non-Hodgkin Lymphoma (NHL), and Chronic Lymphocytic Leukemia (CLL) using a Χ2 test [PMC3576298]. It was found that a CpG island is present near the promoter of MIR129-2 but not MIR129-1 [PMC3576298]. Furthermore, the frequency of MIR129-2 methylation was higher in MM patients at diagnosis compared to patients with Monoclonal Gammopathy of Undetermined Significance (MGUS) [PMC3576298]. The difference in frequency between MM and MGUS was statistically significant with a p-value of 0.023 [PMC3576298]. In summary, the role of MIR129-2 in targeting NG2 in human DIPG was validated using primary DIPG lines. Additionally, the association between methylation of MIR129-2 and other tumor suppressive microRNAs was examined in MM, NHL, and CLL patients. The presence of a CpG island near the promoter of MIR129-2 but not MIR129-1 suggests differential regulation between these two microRNAs. Furthermore, higher frequency of methylation at the CpG island was observed in MM patients at diagnosis compared to patients with MGUS.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCCCUUCGCGAAUCUUUUUGCGGUCUGGGCUUGCUGUACAUAACUCAAUAGCCGGAAGCCCUUACCCCAAAAAGCAUUUGCGGAGGGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications