Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 2 (ENSG00000238942.1) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 2 (ENSG00000238942.1) URS0000651282_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD2: SNORD2 is a small nucleolar RNA (snoRNA) that has been used as a reference for assessing miR-30c levels [PMC4860400]. It has also been used as an internal control for microRNA analysis [PMC4864075]. A synthesized SNORD2 oligoribonucleotide containing a single m6A modification has been used in miCLIP experiments [PMC6774519]. SNORD2 is one of several snoRNAs that have shown decreased levels in the plasma of lung cancer patients compared to healthy donors, suggesting its potential as a biomarker [PMC7140444]. Knocking down SNORD2, along with other snoRNAs, has been shown to significantly alter the splicing profile of their presumed pre-mRNA targets [PMC7038934]. Both the 5' and 3' ends of several SNORDs, including SNORD2, have been recorded in sequencing experiments [PMC4159348]. In various studies, SNORD2 has been found to be upregulated in response to exosome treatment following traumatic brain injury and in invasive breast cancer cell lines [PMC6044101] [PMC8445368]. In cancerous endometrial tissues, increased expression of SNORD116 and SNORD2 was observed, while expression of SNORD3 was decreased [PMC9256700]. Additionally, the snoRNA SNORD2 is found within introns of EIF4A2 and EIF3A genes [PMC8759569], and it is one of the most abundant snoRNAs detected in sequencing experiments [PMC7656686]. Overall, these findings highlight the potential role and significance of SNORD2 in various biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGUGAAAUGAUGGCAAUCAUCUUUCGGGACUGACCUGAAAUGAAGAGAAUACUCAUUGCUGAUCACUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 53 other species

  1. Balaenoptera musculus small nucleolar RNA, C/D box 2 (ENSBMSG00010009083.1)
  2. Bison bison bison (American bison) snoRNA (ENSBBBG00000020306.1)
  3. Bos grunniens (domestic yak) small nucleolar RNA, C/D box 2 (ENSBGRG00000001722.1)
  4. Bos indicus x Bos taurus (hybrid cattle) snoRNA (ENSBIXG00000004678.1, ENSBIXG00005024388.1)
  5. Bos mutus (wild yak) snoRNA (ENSBMUG00000018014.1)
  6. Bos taurus Small nucleolar RNA SNORD2 (ENSBTAG00000044311.2)
  7. Callithrix jacchus (white-tufted-ear marmoset) snoRNA (ENSCJAG00000053654.2)
  8. Camelus dromedarius small nucleolar RNA, C/D box 2 (ENSCDRG00005006975.1)
  9. Camelus ferus Small nucleolar RNA SNORD2
  10. Canis lupus dingo small nucleolar RNA, C/D box 2 (ENSCAFG00020006161.1)
  11. Canis lupus familiaris snoRNA (ENSCAFG00000027814.2, ENSCAFG00030020406.1, ENSCAFG00040017636.1, ENSCAFG00845021673.1)
  12. Capra hircus (Goat) snoRNA (ENSCHIG00000003566.1, ENSCHIG00010011014.1)
  13. Catagonus wagneri small nucleolar RNA, C/D box 2 (ENSCWAG00000019781.1)
  14. Cercocebus atys (Sooty mangabey) snoRNA (ENSCATG00000017457.1)
  15. Cervus hanglu yarkandensis (Yarkand deer) small nucleolar RNA, C/D box 2 (ENSCHYG00000019512.1)
  16. Chlorocebus sabaeus (African green monkey) small nucleolar RNA, C/D box 2 (ENSCSAG00000026646.1)
  17. Choloepus hoffmanni snoRNA (ENSCHOG00000014805.1)
  18. Dasypus novemcinctus snoRNA (ENSDNOG00000027095.1)
  19. Delphinapterus leucas (beluga whale) small nucleolar RNA SNORD2 (ENSDLEG00000014413.1)
  20. Gorilla gorilla gorilla (Western Lowland Gorilla) small nucleolar RNA, C/D box 2 (ENSGGOG00000032407.2)
  21. Loxodonta africana small nucleolar RNA SNORD2 (ENSLAFG00000027916.1)
  22. Macaca fascicularis small nucleolar RNA, C/D box 2 (ENSMFAG00000011567.2)
  23. Macaca mulatta small nucleolar RNA, C/D box 2 (ENSMMUG00000037192.3)
  24. Macaca nemestrina snoRNA (ENSMNEG00000014685.1)
  25. Mandrillus leucophaeus (Drill) snoRNA (ENSMLEG00000027856.1)
  26. Microcebus murinus (gray mouse lemur) snoRNA (ENSMICG00000043385.1)
  27. Monodon monoceros (narwhal) small nucleolar RNA, C/D box 2 (ENSMMNG00015002343.1)
  28. Moschus moschiferus small nucleolar RNA, C/D box 2 (ENSMMSG00000008065.1)
  29. Mustela putorius furo snoRNA (ENSMPUG00000021050.1)
  30. Myotis brandtii Small nucleolar RNA SNORD2
  31. Myotis davidii Small nucleolar RNA SNORD2
  32. Myotis lucifugus small nucleolar RNA SNORD2 (ENSMLUG00000021313.1)
  33. Neogale vison (American mink) snoRNA (ENSNVIG00000020214.1)
  34. Ovis aries snoRNA (ENSOARG00000022667.1, ENSOARG00020000498.2)
  35. Pan paniscus small nucleolar RNA, C/D box 2 (ENSPPAG00000013661.1)
  36. Pan troglodytes small nucleolar RNA, C/D box 2 (ENSPTRG00000037854.2)
  37. Papio anubis (olive baboon) snoRNA (ENSPANG00000034011.2)
  38. Phocoena sinus small nucleolar RNA SNORD2 (ENSPSNG00000006371.1)
  39. Physeter catodon small nucleolar RNA, C/D box 2 (ENSPCTG00005010832.1)
  40. Piliocolobus tephrosceles snoRNA (ENSPTEG00000011478.1)
  41. Pongo abelii snoRNA (ENSPPYG00000028034.2)
  42. Pteropus alecto (black flying fox) Small nucleolar RNA SNORD2
  43. Pteropus vampyrus (large flying fox) snoRNA (ENSPVAG00000024664.1)
  44. Rhinolophus ferrumequinum small nucleolar RNA, C/D box 2 (ENSRFEG00010010824.1)
  45. Rhinopithecus bieti (Black snub-nosed monkey) snoRNA (ENSRBIG00000015782.1)
  46. Rhinopithecus roxellana snoRNA (ENSRROG00000003033.1)
  47. Sciurus vulgaris small nucleolar RNA, C/D box 2 (ENSSVLG00005008914.1)
  48. Suricata suricatta small nucleolar RNA, C/D box 2 (ENSSSUG00005005885.1)
  49. Sus scrofa snoRNA (multiple genes)
  50. Theropithecus gelada small nucleolar RNA SNORD2 (ENSTGEG00000022950.1)
  51. Tursiops truncatus (bottlenosed dolphin) snoRNA (ENSTTRG00000023870.1)
  52. Vicugna pacos (alpaca) snoRNA (ENSVPAG00000015840.1)
  53. Zalophus californianus (california sea lion) snoRNA (ENSZCAG00015013248.1)
2D structure Publications