Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) snoRNA (ENSG00000252904.1) secondary structure diagram

Homo sapiens (human) snoRNA (ENSG00000252904.1) URS0000650FE5_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA76: SNORA76 is a snoRNA (small nucleolar RNA) that has been studied in various contexts. One study found that the transcript of SNORA76 quantified by PCR assay was different from that measured by microarray hybridization, suggesting a discrepancy in the gene expression values [PMC6482147]. Additionally, there was a negative correlation between the gene expression values measured by microarray and RT-qPCR for SNORA76 [PMC6482147]. SNORA76 is one of the snoRNAs that occur as intronic sequences within host genes, although it is one of the four monocistronic SNORA/D genes [PMC7090452]. In terms of expression patterns, SNORA76 has been found to be enriched in Ep-CAM-Exos [PMC7461500]. The mouse genome contains one copy of SNORA76 [PMC2832892], and there are also two paralogs of rhesus monkey SNORA76 [PMC2832892]. Overall, these findings highlight the importance and variability of SNORA76 in different biological contexts.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCACAUUUUAUCAACCAAAUGAAUUAGGGAAAAAAGUUCAUGCCCAGGGGUGAGACUAUAGUGCCAGAACACUUGCUUGUGCAUAAUUAAGGCCACUUGCCCUCUUCAGGUAGCCCUUUUAACUGGGAGCAAAGUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications