Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 3B-1 (SNORD3B-1, SNORD3B-2) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 3B-1 (SNORD3B-1, SNORD3B-2) URS0000650B1E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD3B-2: SNORD3B-2, a circRNA, has been identified as a potential diagnostic biomarker for hepatocellular carcinoma (HCC) when combined with miR-122 [PMC10060991]. The structure profile of SNORD3B-2 has been collected from the Rfam database and its RNA binding protein (RBP) binding hotspots from the POSTAR2 database [PMC7681086]. A 3-RNA panel consisting of SNORD3B-2, circ-0080695, and miR-122 showed the highest diagnostic accuracy for HCC [PMC7681086]. SNORD3B-2 and circ-0073052 are considered reliable plasma biomarkers for HCC, and their high abundance in plasma may be attributed to stable RNA secondary structures or association with RBPs [PMC7681086]. The combination of SNORD3B-2, circ-0080695, and miR-122 has been selected as a 3-RNA detection panel for liver cancer [PMC7681086]. SNORD3B-2 is one of the potential exRNA biomarkers selected for further analysis in liver cancer [PMC7681086]. The dysregulation of SNORD3B-2 is associated with age-related immune dysfunction and pathogenesis of Alzheimer's disease [PMC9359077]. SNORD3B-2 is also upregulated in CD14+ monocytes in White individuals and may be involved in biological pathways regulated by progranulin26 [PMC8060402]. Additionally, a panel consisting of SNORD3B-2, circ0080695, and miR122 showed high accuracy in classifying liver cancer patients from healthy donors [PMC8855550].

Targeting miRNAs 3 total

According to LncBase, this RNA is targeted by the following miRNAs:

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGACUAUACUUUCAGGGAUCAUUUCUAUAGUGUGUUACUAGAGAAGUUUCUCUGAACGUGUAGAGCACCGAAAACCCCGAGGAAGAGAGGUAGCGUUUUCUCCUGAGCGUGAAGCCGGCUUUCUGGCGUUGCUUGGCUGCAACUGCCGUCAGCCAUUGAUGAUCGUUCUUCUCUCCGUAUUGGGGAGUGAGAGGGAGAGAACGCGGUCUGAGUGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications