Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-575 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-575 precursor URS000064FA6C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-575: Hsa-mir-575 is a microRNA that has been studied in various diseases, including pancreatic ductal adenocarcinoma (PDAC), salivary exosomal samples, and breast cancer [PMC7733931] [PMC5902673] [PMC7196262] [PMC5649611] [PMC7795580] [PMC9877296]. It has been found to be significantly up-regulated in CP salivary-exosomal samples, except for hsa-mir-575 and hsa-miR-4793-3p, which had lower AUC values compared to other miRNAs [PMC7733931]. Hsa-mir-575 has also been identified as a potential oncomiRNA in various tumors, including gastric cancer, lung cancer, renal cell carcinoma, hepatocellular carcinoma, and breast cancer. It targets genes such as BLID (BH3-like motif containing BRCC2) and is involved in PCa oncogenesis [PMC7196262]. In PDAC tissues compared to adjacent normal controls, hsa-mir-575 was found to be up-regulated along with other miRNAs such as hsa-miR-10b and hsa-miR-382. Conversely, miRNAs like hsa-miR-1 and hsa-miR-19a were down-regulated in PDAC tissues [PMC5649611]. Hsa-mir-575 has also been studied in irradiated human embryonic stem cells (hESC), where its upregulation was associated with the prevention of cell differentiation. However, further studies are needed to fully understand its exact function in this context [PMC3275573]. In breast cancer (MBC), hsa-mir-575 was found to be down-regulated along with other miRNAs like hsa-miR-125b and hsa-miR-214-3p [PMC5820911]. Hsa-mir-575, along with hsa-miR-1973, hsa-miR-630, and hsa-miR-600, are miRNAs that have not been previously associated with prostate cancer (PCa) and require further characterization [PMC7196262].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAUUCAGCCCUGCCACUGGCUUAUGUCAUGACCUUGGGCUACUCAGGCUGUCUGCACAAUGAGCCAGUUGGACAGGAGCAGUGCCACUCAACUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Pan paniscus microRNA 575 (ENSPPAG00000003554.1)
  2. Pan troglodytes miRNA
2D structure Publications